rachael price

 

señoras, señores, tomen asiento, relájense y disfruten de una de las cantantes más increíbles del planeta, vean a rachael price, de los bostonianos lake street dive, grabando la voz en esta maravillosa pieza de su recientemente publicado álbum, bad self-portraits.

37 comentarios:

  1. Vaya voz...Para bailar en pareja es genial...Me encanta...

    Un beso Raúl!

    ResponderEliminar
    Respuestas
    1. es tremenda, yo no me termino de explicar cómo demonios respira, después de esos profundos intervalos exhalatorios, es una fiera, me encanta cómo en el primer "see me" intenta mantener la compostura facial para abandonarse definitivamente después, dando manotazos en el aire. un beso :)

      Eliminar
  2. Rachael tiene voz para el blues, indudablemente. Me gustó su presentación, puesto que no la conocía.
    Besos de tarde, mi querido Raúl.
    p.d. Al hilo de mi anterior comentario y tu respuesta, decirte (aunque aquí no venga al caso) que sería un momento idóneo para un referéndum y un detalle por parte de los poderes políticos y del sucesor de turno. Que sea el pueblo el que decida la forma de organizar el Estado es la verdadera democracia, no las imposiciones basadas en la herencia y en la tradición... (espero no haberte molestado por responderte aquí:)

    ResponderEliminar
    Respuestas
    1. no me molesta para nada, y si se trata de respuestas tan coherentes como esta, mucho menos todavía! besos de tarde :)

      Eliminar
  3. genial ! (es una estraterrestre, no respira ... yo me ahogo sólo con escucharla)

    ResponderEliminar
    Respuestas
    1. ya te digo, se necesita mucha técnica vocal para sostener esa voz tan clara, tan nítida, tanto tiempo, y un diafragma XXL, también! :)

      Eliminar
  4. Vaya pasada de voz!!! Me ha encantado!!

    ResponderEliminar
    Respuestas
    1. es muy buena, verdad? tiene un dominio, una solvencia, admirable

      Eliminar
  5. Puff qué maravilla!! Gracias por poner banda sonora a mi viernes!

    ResponderEliminar
  6. ¿Bad?, no he visto mejor autorretrato que este debut. Brutal.

    ResponderEliminar
    Respuestas
    1. bueno, ya tiene algún disco publicado, no son debutantes, pero sí son geniales, eso seguro. tienen actuaciones en directo para aburrir en el tubo, hacen soul, hacen jazz, hagan lo que hagan, lo hacen muy bien.

      Eliminar
  7. Grandísima voz, sí señor! Me ha encantado este descubrimiento!

    ResponderEliminar
    Respuestas
    1. es una gozada, verdad? este grupo mola mucho

      Eliminar
  8. ¡Preciosa y sensual voz!!!!!!!!!

    ResponderEliminar
  9. Collons qué vozarrón, la primera vez que oigo hablar de ella.

    ResponderEliminar
    Respuestas
    1. es una fiera, escribe, compone (este tema es suyo), toca la guitarra...

      Eliminar
  10. Blusera total... Me encanta.
    Una maravilla.
    Gracias por presentármela.
    :)
    Feliz Sábado.

    ResponderEliminar
    Respuestas
    1. sabía que te iba a gustar, presidenta, feliz domingo! :)

      Eliminar
  11. y soulera... Soul blues... anyway... profunda e intensa.

    ResponderEliminar
  12. Qué voz! Por cierto, felicidades por los 10 000 y más! Abrazos grandes.

    ResponderEliminar
  13. ¡Me encanta! - ¿Cómo se hace para cantar así? - ¿O la mitad? - ¿O un cuartito? - ¿O...?. Gracias por el descubrimiento, again.

    Saludos! ☺

    ResponderEliminar
    Respuestas
    1. a mi me encantaría conocer la fórmula secreta, desde luego :)

      Eliminar
  14. ¡GUUUUUUUAAAAAAUUUUUUUU! ¡QUÉ BUENO PARA EMPEZAR LA SEMANA!

    ResponderEliminar
    Respuestas
    1. este grupo es genial, apto para cualquier día de la semana! :)

      Eliminar
  15. guau! qué bonito es empezar la semana sorprendiéndose de este modo...gracias, mestre...entre tú y mi adorado Johnny no paro de fagocitar cosas nuevas y me encanta (10.059????, es eso posible????, cuando rellenas los formularios en la cola del paro te apuntan también como seguidor tuyo????....joer, es de locos, estás que te sales!!!!)

    Kissessss.

    ResponderEliminar
    Respuestas
    1. muchas gracias, amiga, si pudiera ofertar trabajo, en este país, la cifra de seguidores se multiplicaría por 10!! un poco de música aquí y alguna que otra frase chorra allá es lo único que puedo ofrecer, sin embargo :)

      Eliminar
  16. Si, es una delicia de canción.
    Llena de energía y al mismo tiempo muy relajante.
    Creo que me haré con el disco entero. Promete.
    Besossss.

    ResponderEliminar
    Respuestas
    1. son geniales, date una vuelta por el tubo para ver alguna actuación, que te enamorarás todavía más. besos!

      Eliminar
  17. Maravillosa voz la de esta chica... es de esas que se te meten por dentro... muchas gracias por tus regalos musicales

    ResponderEliminar
    Respuestas
    1. una voz que arropa, es verdad, excepcional.

      Eliminar
  18. estupenda cantante

    salud

    ResponderEliminar